(NAS Colloquium) Links Between Recombination and Replication: Vital Roles of Recombination

The following HTML text is provided to enhance online readability. Many aspects of typography translate only awkwardly to HTML. Please use the page image as the authoritative form to ensure accuracy.

Colloquium on Links Between Recombination and Replication: Vital Roles of Recombination

cated plasmid (12). It may also be driven enzymatically. In vivo evidence suggests that regression of damaged forks to form Holliday junctions might involve the strand exchange activity of RecA (13). However, it is not known whether RecA-mediated strand exchange can catalyze the regression of stalled replication forks directly. A second enzymatic mechanism for fork regression utilizes the monomeric helicase RecG. We have shown that RecG can stimulate Holliday junction-specific endonucleases to cleave model fork structures in vitro, and that RecG is required to promote formation of Holliday junctions from damaged replication forks in vivo (8, 14). Moreover, we have also shown that RecG can unwind true replication forks reconstituted in vitro and that it can overcome the energetic barrier to fork regression when the fork is in a region of negative superhelicity (34). However, the role of RecG is not simply to process stalled forks into substrates for RuvABC [Fig. 1A (i)]. In conjunction with PriA, it appears to facilitate fork progression without the need for RuvABC-catalyzed cleavage of the chromosome and subsequent formation of a D-loop by recombination (8). This might involve RecG-catalyzed regression of a stalled fork to promote access of repair enzymes to the blocking lesion, followed by reversal of the regression to reestablish a fork structure that can be targeted directly by PriA [Fig. 1A (ii)]. RecG may also be important when a lesion affecting only a single strand of the parental duplex is encountered by a fork. If such a lesion is present on the lagging strand template then the replisome may prematurely terminate an Okazaki fragment at the lesion and continue synthesis downstream (15), leaving a gap that can then be repaired by RecA-dependent mechanisms (16). A lesion in the leading strand template presents a different problem because the two polymerases might decouple, allowing lagging strand synthesis to continue some way beyond the block (15, 17, 18). If such a process does occur, then the result would be a gap in the leading strand (Fig. 1B). In such a case, we have proposed that RecG might promote template switching via a mechanism in which regression of the stalled fork to form a Holliday junction allows the lagging strand to act as a template for leading strand synthesis (8). Assuming regression could be reversed, a normal fork might be reestablished via PriA. Such mechanisms would allow replication to proceed without the need for RuvABC-dependent cleavage of the fork.

Collapse of the fork appears to be essential when a fork encounters a lesion that blocks progression of the replicative helicase, DnaB, and which therefore might necessitate recombination with a sister duplex to bypass the lesion (8). However, chromosomal breakage is a dangerous process because there is a risk that the free DNA end will undergo illegitimate recombination leading to potentially fatal genome rearrangements. RecG provides the cell with a second pathway for replication restart that may allow replication to continue in the face of lesions affecting a single strand of the template, but which does not necessitate breakage of the fork (8).

The modification of replication fork structures is emerging as a crucial factor in the maintenance of fork progression in E. coli. These processes may also be essential in eukaryotes. Holliday junctions have been directly observed in yeast within rDNA (19) and are coincident with the position of a preprogrammed replication fork block. Moreover, such blocks may coincide with hot spots of recombination and therefore of genome instability (20). Indeed, accumulating evidence suggests that genetic instabilities seen in certain human diseases may be attributable to aberrant processing of stalled replication forks (21).

The precise roles of RecG and RuvABC at stalled forks remain to be determined. Here we show that RecG actively unwinds the leading and lagging strands of partial fork structures in vitro by simultaneous translocation along the leading and lagging strand templates at the fork. Disruption of one of these translocation activities leads to a dramatic inhibition of the other, as revealed by the decrease in unwinding of the relevant duplex arm at the fork. Thus, RecG employs a mechanism that involves simultaneous tracking along two DNA strands with opposing polarities. In vivo, such a reaction may promote formation of a Holliday junction from a damaged fork. These data support a model in which RecG is a replication fork-specific helicase that modulates the structure of a stalled fork to facilitate replication restart.

Materials and Methods

DNA Substrates. χ^Sma DNA was prepared as described (8). Small forked DNA junctions were constructed by using oligonucleotides, one of which in each structure was labeled with [γ³²P]ATP at the 5′ end, and purified by gel electrophoresis (22). Sequences of the oligonucleotides, written 5′-3′, are: (a) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC; (b) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (c) TGCCGAATTCTACCAGTGCCAGTGAT; (d) TAGCAATGTAATCGTCTATGACGTT; (e) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (f) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (g) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC; (h) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC; (i) ACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (j) TACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (k) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGT; (l) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCA; (m) TAGCAATGTAATCGTCTATG; (n) ATTCTACCAGTGCCAGTGAT. Italic nucleotides indicate those in which the polarity of the phosphate backbone was reversed with respect to the flanking sequences. These oligonucleotides were synthesized by using 5′ cyanoethyl phosphoramidites (Glen Research, Sterling, VA). Oligonucleotide d contained a 5′ terminal phosphate group made by using Phosphalink (Perkin-Elmer).

The small forks in Figs. 3 and 7 were made by annealing combinations of a, b, c, and d. Junctions having a region of reverse polarity in the lagging strand template (Fig. 4A) were made by using a, b, and c (no reversal of polarity); a, c, and e (six-base reversal); a, c, and f (12-base reversal). Junctions having a region of reverse polarity in the leading strand template (Fig. 4B) were made by using a, b, and d (no reversal); b, d, and g (six-base reversal); b, d, and h (12-base reversal). Junctions with truncations in the lagging strand template (Fig. 5A) were constructed by annealing a, b, and c (no truncation, 26-base arm); a, c, and i (15-base arm); a, c, and j (ten-base arm). Junctions with truncations in the leading strand template (Fig. 5B) were made by using a, b, and d (no truncation, 25-base arm); b, d, and k (15-base arm); b, d, and l (ten-base arm). Junctions used in Fig. 6A were constructed with (i) a, b, and d; (ii) a, b, and m; (iii) b, d, and l; and (iv) b, l, and m. Junctions in Fig. 6B were constructed with (i) a, b, and c; (ii) a, b, and n; (iii) a, c, and j; and (iv) a, j, and n.

Proteins. Wild-type RecG and RecGK302A were purified as described (23). All concentrations are expressed in terms of protein monomer.

Enzyme Assays. The stimulation of RuvC cleavage of χ^Sma by RecG was measured as described (8). Reactions were incubated for 30 min at 37°C before deproteinization.

Dissociation of small oligonucleotide junction structures was performed as described (23), except that the buffer system was 50 mM Tris-acetate (pH 8), 20 mM potassium acetate, 1 mM DTT, and 0.1 mg/ml BSA. ATP and magnesium acetate were both used at a concentration of 5 mM. Reactions in which

Free Resources

Related Titles