Questions? Call 888-624-8373

PAPERBACK
list:$62.25
Web:$56.02
add to cart

Rights & Permissions

topleft topright

(NAS Colloquium) Links Between Recombination and Replication: Vital Roles of Recombination (2002)
Proceedings of the National Academy of Sciences (PNAS)

Page
57
bottomleft bottomright

The following HTML text is provided to enhance online readability. Many aspects of typography translate only awkwardly to HTML. Please use the page image as the authoritative form to ensure accuracy.


Colloquium on Links Between Recombination and Replication: Vital Roles of Recombination

cated plasmid (12). It may also be driven enzymatically. In vivo evidence suggests that regression of damaged forks to form Holliday junctions might involve the strand exchange activity of RecA (13). However, it is not known whether RecA-mediated strand exchange can catalyze the regression of stalled replication forks directly. A second enzymatic mechanism for fork regression utilizes the monomeric helicase RecG. We have shown that RecG can stimulate Holliday junction-specific endonucleases to cleave model fork structures in vitro, and that RecG is required to promote formation of Holliday junctions from damaged replication forks in vivo (8, 14). Moreover, we have also shown that RecG can unwind true replication forks reconstituted in vitro and that it can overcome the energetic barrier to fork regression when the fork is in a region of negative superhelicity (34). However, the role of RecG is not simply to process stalled forks into substrates for RuvABC [Fig. 1A (i)]. In conjunction with PriA, it appears to facilitate fork progression without the need for RuvABC-catalyzed cleavage of the chromosome and subsequent formation of a D-loop by recombination (8). This might involve RecG-catalyzed regression of a stalled fork to promote access of repair enzymes to the blocking lesion, followed by reversal of the regression to reestablish a fork structure that can be targeted directly by PriA [Fig. 1A (ii)]. RecG may also be important when a lesion affecting only a single strand of the parental duplex is encountered by a fork. If such a lesion is present on the lagging strand template then the replisome may prematurely terminate an Okazaki fragment at the lesion and continue synthesis downstream (15), leaving a gap that can then be repaired by RecA-dependent mechanisms (16). A lesion in the leading strand template presents a different problem because the two polymerases might decouple, allowing lagging strand synthesis to continue some way beyond the block (15, 17, 18). If such a process does occur, then the result would be a gap in the leading strand (Fig. 1B). In such a case, we have proposed that RecG might promote template switching via a mechanism in which regression of the stalled fork to form a Holliday junction allows the lagging strand to act as a template for leading strand synthesis (8). Assuming regression could be reversed, a normal fork might be reestablished via PriA. Such mechanisms would allow replication to proceed without the need for RuvABC-dependent cleavage of the fork.

Collapse of the fork appears to be essential when a fork encounters a lesion that blocks progression of the replicative helicase, DnaB, and which therefore might necessitate recombination with a sister duplex to bypass the lesion (8). However, chromosomal breakage is a dangerous process because there is a risk that the free DNA end will undergo illegitimate recombination leading to potentially fatal genome rearrangements. RecG provides the cell with a second pathway for replication restart that may allow replication to continue in the face of lesions affecting a single strand of the template, but which does not necessitate breakage of the fork (8).

The modification of replication fork structures is emerging as a crucial factor in the maintenance of fork progression in E. coli. These processes may also be essential in eukaryotes. Holliday junctions have been directly observed in yeast within rDNA (19) and are coincident with the position of a preprogrammed replication fork block. Moreover, such blocks may coincide with hot spots of recombination and therefore of genome instability (20). Indeed, accumulating evidence suggests that genetic instabilities seen in certain human diseases may be attributable to aberrant processing of stalled replication forks (21).

The precise roles of RecG and RuvABC at stalled forks remain to be determined. Here we show that RecG actively unwinds the leading and lagging strands of partial fork structures in vitro by simultaneous translocation along the leading and lagging strand templates at the fork. Disruption of one of these translocation activities leads to a dramatic inhibition of the other, as revealed by the decrease in unwinding of the relevant duplex arm at the fork. Thus, RecG employs a mechanism that involves simultaneous tracking along two DNA strands with opposing polarities. In vivo, such a reaction may promote formation of a Holliday junction from a damaged fork. These data support a model in which RecG is a replication fork-specific helicase that modulates the structure of a stalled fork to facilitate replication restart.

Materials and Methods

DNA Substrates. χSma DNA was prepared as described (8). Small forked DNA junctions were constructed by using oligonucleotides, one of which in each structure was labeled with [γ32P]ATP at the 5′ end, and purified by gel electrophoresis (22). Sequences of the oligonucleotides, written 5′-3′, are: (a) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC; (b) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (c) TGCCGAATTCTACCAGTGCCAGTGAT; (d) TAGCAATGTAATCGTCTATGACGTT; (e) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (f) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (g) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC; (h) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC; (i) ACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (j) TACATTGCTACATGGAGCTGTCTAGAGGATCCGA; (k) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGT; (l) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCA; (m) TAGCAATGTAATCGTCTATG; (n) ATTCTACCAGTGCCAGTGAT. Italic nucleotides indicate those in which the polarity of the phosphate backbone was reversed with respect to the flanking sequences. These oligonucleotides were synthesized by using 5′ cyanoethyl phosphoramidites (Glen Research, Sterling, VA). Oligonucleotide d contained a 5′ terminal phosphate group made by using Phosphalink (Perkin-Elmer).

The small forks in Figs. 3 and 7 were made by annealing combinations of a, b, c, and d. Junctions having a region of reverse polarity in the lagging strand template (Fig. 4A) were made by using a, b, and c (no reversal of polarity); a, c, and e (six-base reversal); a, c, and f (12-base reversal). Junctions having a region of reverse polarity in the leading strand template (Fig. 4B) were made by using a, b, and d (no reversal); b, d, and g (six-base reversal); b, d, and h (12-base reversal). Junctions with truncations in the lagging strand template (Fig. 5A) were constructed by annealing a, b, and c (no truncation, 26-base arm); a, c, and i (15-base arm); a, c, and j (ten-base arm). Junctions with truncations in the leading strand template (Fig. 5B) were made by using a, b, and d (no truncation, 25-base arm); b, d, and k (15-base arm); b, d, and l (ten-base arm). Junctions used in Fig. 6A were constructed with (i) a, b, and d; (ii) a, b, and m; (iii) b, d, and l; and (iv) b, l, and m. Junctions in Fig. 6B were constructed with (i) a, b, and c; (ii) a, b, and n; (iii) a, c, and j; and (iv) a, j, and n.

Proteins. Wild-type RecG and RecGK302A were purified as described (23). All concentrations are expressed in terms of protein monomer.

Enzyme Assays. The stimulation of RuvC cleavage of χSma by RecG was measured as described (8). Reactions were incubated for 30 min at 37°C before deproteinization.

Dissociation of small oligonucleotide junction structures was performed as described (23), except that the buffer system was 50 mM Tris-acetate (pH 8), 20 mM potassium acetate, 1 mM DTT, and 0.1 mg/ml BSA. ATP and magnesium acetate were both used at a concentration of 5 mM. Reactions in which

Page
57
Front Matter (R1-R3)
Links between recombination and replication: Vital roles of recombination (8172-8172)
Historical overview: Searching for replication help in all of the rec places (8173-8180)
Rescue of arrested replication forks by homologous recombination (8181-8188)
Circles: The replication-recombination-chromosome segregation connection (8189-8195)
Participation of recombination proteins in rescue of arrested replication forks in UV-irradiated Escherichia coli need not involve recombination (8196-8202)
Effects of mutations involving cell division, recombination, and chromosome dimer resolution on a priA2::kan mutant (8203-8210)
RecA protein promotes the regression of stalled replication forks in vitro (8211-8218)
Topological challenges to DNA replication: Conformations at the fork (8219-8226)
Rescue of stalled replication forks by RecG: Simultaneous translocation on the leading and lagging strand templates supports an active DNA unwinding model of fork reversal and Holliday junction formation (8227-8234)
Formation of Holliday junctions by regression of nascent DNA in intermediates containing stalled replication forks: RecG stimulates regression even when the DNA is negatively supercoiled (8235-8240)
Single-strand interruptions in replicating chromosomes cause double-strand breaks (8241-8246)
Handoff from recombinase to replisome: Insights from transportation (8247-8254)
Break-induced replication: A review and an example in budding yeast (8255-8262)
Links between replication and recombination in Saccharomyces cerevisiae: A hypersensitive requirement for homologous recombination in the absence of Rad27 activity (8263-8269)
Evidence that replication fork components catalyze establishment of cohesion between sister chromatids (8270-8275)
Rad52 forms DNA repair and recombination centers during S phase (8276-8282)
A yeast gene, MGS1, encoding a DNA-dependent AAA+ ATPase is required to maintain genome stability (8283-8289)
The tight linkage between DNA replication and double-strand break repair in bacteriophage T4 (8290-8297)
Mediator proteins orchestrate enzyme-ssDNA assembly during T4 recombination-dependent DNA replication and repair (8298-8305)
Two recombination-dependent DNA replication pathways of bacteriophage T4, and their roles in mutagenesis and horizontal gene transfer (8306-8311)
Bacteriophage T4 gene 41 helicase and gene 59 helicase-loading protein: A versatile couple with roles in replication and recombination (8312-8318)
Instability of repetitive DNA sequences: The role of replication in multiple mechanisms (8319-8325)
Repeat expansion by homologous recombination in the mouse germ line at palindromic sequences (8326-8333)
Stationary-phase mutation in the bacterial chromosome: Recombination protein and DNA polymerase IV dependence (8334-8341)
Managing DNA polymerases: Coordinating DNA replication, DNA repair, and DNA recombination (8342-8349)
Roles of DNA polymerases V and II in SOS-induced error-prone and error-free repair in Escherichia coli (8350-8354)
Accuracy of lesion bypass by yeast and human DNA polymerase n (8355-8360)
ATP bound to the orgin recognition complex is important for preRC formation (8361-8367)
Creating a dynamic picture of the sliding clamp during T4 DNA polymerases holoenzyme assembly by using fluorescence resonance energy transfer (8368-8375)
Interaction of the ß sliding clamp with MutS, ligase, and DNA polymerase I (8376-8380)
Defining the roles of individual residues in the single-stranded DNA binding site of PcrA helicase (8381-8387)
Homologous DNA recombination in vertebrate cells (8388-8394)
Meiotic recombination and chromosome segregation in Schizosaccharomyces pombe (8395-8402)
Manipulating the mammalian genome by homologous recombination (8403-8410)
Assembly of RecA-like recombinases: Distinct roles for mediator proteins in mitosis and meiosis (8411-8418)
Domain structure and dynamics in the helical filaments formed by RecA and Rad51 on DNA (8419-8424)
Homologous genetic recombination as an intrinsic dynamic property of a DNA structure induced by RecA/Rad51-family proteins: A possible advantage of DNA over RNA as genomic material (8425-8432)
The synaptic activity of HsDmc1, a human reccombination protein specific to meiosis (8433-8439)
Complex formation by the human RAD51C and XRCC3 recombination repair proteins (8440-8446)
Rad54 protein stimulates the postsynaptic phase of Rad51 protein-mediated DNA strand exchange (8447-8453)
The architecture of the human Rad54-DNA complex provides evidence for protein translocation along DNA (8454-8460)
DNA replication meets genetic exchange: Chromosomal damage and its repair by homologous recombination (8461-8468)
Colloquium Program (8469-8471)