. "AvrPto-dependent Pto-interacting Proteins and AvrPto-interacting Proteins in Tomato." (NAS Colloquium) Virulence and Defense in Host--Pathogen Interactions: Common Features Between Plants and Animals. Washington, DC: The National Academies Press, 2001.
The following HTML text is provided to enhance online
readability. Many aspects of typography translate only awkwardly to HTML.
Please use the page image
as the authoritative form to ensure accuracy.
COLLOQUIUM ON Virulence and Defense in Host—Pathogen Interactions: Common Features Between Plants and Animals
Fig. 1. Yeast three-hybrid hunt for AvrPto-dependent Pto-interacting (Adi) proteins. Coexpression of AvrPto fused to a nuclear localization signal and of Pto fused to the DNA-binding domain (DBD) of the LexA transcriptional activator (bait fusion) made it possible to screen a library of tomato cDNA clones fused to the activation domain (AD) of LexA (prey fusion) for proteins that interact with an AvrPto-Pto complex (A) or with Pto that had assumed an AvrPto-dependent conformation (B). Association of the bait and prey reconstitutes the LexA transcriptional activator and drives expression of reporter genes (lacZ and leu2) under the control of the LexA operator (LexAop). Pto interaction with candidate Adi clones is later tested for AvrPto-dependence.
cassette (21) was subcloned into pBluescript II SK(−) (Stratagene), yielding plasmid pBOG5. avrPto was amplified from pPTE6 (4) by the PCR by using primers avrPtoFP2 (5′ GGGTATACAGCTGGGAAATATATGTGTCGG 3′), which contains a PvuII site (underlined) and a Met to Leu change at the initiator codon (italicized), and avrPtoRP2 (5′ ACGCACTCGAGAACCTCTGCACTCACC 3′), which contains an XhoI site (underlined). The portion of pBOG5 encoding the activation domain and the HA epitope tag was excised by cutting with EcoRV and XhoI, and was replaced with the avrPto PCR product cut with PvuII and XhoI. The ligation destroyed the EcoRV and PvuII sites and resulted in an in-frame fusion of avrPto to the nuclear localization signal sequence of the prey construct. Nucleotide sequence of the fusion junction and the avrPto gene was confirmed. The construct was excised by digestion with PvuII and SacI, which cut in the vector, and was cloned into the reporter plasmid pSH18-34 (21) that had been cut with SmaI and SacI, releasing a 2.8-kb fragment containing the 5′ end of the lacZ reporter gene. This plasmid was designated as pBOG7. Finally, the reporter gene was restored by reinsertion of the 2.8-kb SmaI/SacI fragment between the unique NotI and SacI sites of pBOG7 to yield pBOG8. The tomato cDNA library previously used to isolate Pti proteins was then screened by using Pto as a bait as described (16, 21) but substituting pBOG8 for pSH18-34. In this way, we were able to search for clones encoding proteins that interacted with an AvrPto-Pto complex or with Pto that had assumed an AvrPto-dependent conformation (Fig. 1). Sixty million primary transformants were obtained, and after plating to obtain a 3× representation, 3,780 leucine prototrophs were obtained. Of these, 84 showed strong activation of the lacZ reporter gene, and 155 weak. Partial DNA sequence was determined for each of these and compared against the GenBank database by using the BLASTX algorithm (22). Clones showing similarity to abundant housekeeping transcripts such as RUBISCO and ubiquitin, as well as clones representing 2 isopropylmalate dehydrogenase (functionally equivalent to the leu2 gene) were eliminated. Remaining clones were grouped into classes (26 total) according to identity based on BLASTX results or DNA sequence identity. For a representative clone of each class, interaction with Pto was retested for AvrPto-dependence and was tested for specificity, including possible interaction with AvrPto alone (using the non-autoactivating AvrPto bait construct described herein) as shown in Fig. 2A. Five classes of AvrPto-dependent Pto-interacting (Adi) proteins were identified (Table 1). Some of the Adi proteins showed weak interaction with Pto alone based on activation of the leu2 gene (Fig. 2A; Table 2), which is a more sensitive indicator of interaction than the lacZ gene in our experience. Nevertheless, the interaction in each case was greatly enhanced by AvrPto.
Adi1. Adi1 is tomato catalase 1 (23), and represents the largest class in the screen (17 isolates). Protein expressed from a full-length cDNA was active (Fig. 3). Truncated cDNAs encoding the C terminus of the highly similar tomato catalase 2 (GenBank accession no. AF112368) were also isolated that showed a weak AvrPto-dependent interaction with Pto, suggesting that the interacting domain of Adi1 may reside in the C terminus. An interaction of Adi1 with Pto in the plant resulting in inactivation or turnover of this H2O2-scavenger might contribute to the oxidative burst. Adi1 is a member of the class II catalase group that includes the salicylic acid-binding catalase of
Fig. 2. Test for AvrPto-dependence and specificity of Adi protein interactions with Pto, and for specificity of Api protein interactions with AvrPto. Individual yeast transformants expressing each of the indicated three-or two-hybrid protein combinations were streaked to minimal medium agar plates containing 40 µg/ml X-gal to assay expression of the lacZ reporter gene, indicated by a developing blue color, and to minimal medium lacking leucine to assay expression of the leu2 reporter gene, indicated by growth. The Drosophila proteins Bicoid and Dorsal were used as arbitrary bait and prey fusions (kindly provided by R. Brent, Massachusetts General Hospital) for testing the specificity of the interactions observed. (A) Adi clones were tested in yeast containing the indicated constructs. Shown are results for Adi1. Results for all of the Adi proteins are summarized in Table 1. The interaction of Pto and AvrPto is shown for reference. (B) Lack of autoactivation and confirmed interaction with Pto by the AvrPto-LexA fusion used in the hunt for AvrPto interactors. Pto prey fusion was constructed previously by X. Tang in our laboratory. ( C) Api clones were tested in yeast containing the indicated constructs. Shown are results for Api1. Results for all of the Adi proteins are summarized in Table 2.