Questions? Call 888-624-8373

PAPERBACK
list:$29.00
Web:$26.10
add to cart

Rights & Permissions

topleft topright

(Sackler NAS Colloquium) Chemical Communication in a Post-Genomic World (2003)
Proceedings of the National Academy of Sciences (PNAS)

Page
57
bottomleft bottomright
Page
57
Front Matter (R1-R4)
1 Chemical communication in a post-genomic world (1-1)
2 Understanding the chemistry of chemical communication: Are we there yet? (2-4)
3 Chemical ecology: Can it survive without natural products chemistry? (5-6)
4 Pheromone-mediated gene expression in the honey bee brain (7-13)
5 Drosophila Gr5a encodes a taste receptor tuned to trehalose (14-18)
6 Mammalian TRPV4 (VR-OAC) directs behavioral responses to osmotic and mechanical stimuli in Caenorhabditis elegans (19-24)
7 Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster (25-30)
8 A genomic perspective on nutrient provisioning by bacterial symbionts of insects (31-36)
9 Chemical communication among bacteria (37-42)
10 Synergy and contingency as driving forces for the evolution of multiple secondary metabolite production by Streptomyces species (43-49)
11 Efficient oxidative folding of conotoxins and the radiation of venomous cone snails (50-56)
12 Non-self recognition, transcriptional reprogramming, and secondary metabolite accumulation during plant/pathogen interactions (57-64)
13 Systemins: A functionally defined family of peptide signals that regulate defensive genes in Solanaceae species (65-68)
14 Manduca sexta recognition and resistance among allopolyploid Nicotiana host plants (69-74)
15 Evolutionary dynamics of an Arabidopsis insect resistance quantitative trait locus (75-80)
16 Diversification of furanocoumarin-metabolizing cytochrome P450 monooxygenases in two papilionids: Specificity and substrate encounter rate (81-86)
17 Molecular genetics and evolution of pheromone biosynthesis in Lepidoptera (87-94)

Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter. Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.

Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.

OCR for page 57
Colloquium Non-seIf recognition, transcriptional reprogramming, and secondary metabo~ite accumulation during plant/pathogen interactions Klaus Hahlbrock*t, Pawel Bednarek*, Ingo Ciolkowski*, Bjorn Hamberger*, Andreas Heise*, Hiltrud Liedgenst, El ke Logemann *, Thorsten Nurnberger§, Elmon Schmeizer*, Imre E. Somssich*, and Jianwen Tan* *Max-Planck-lnstitut fur Zuchtungsforschung, Carl-von-Linne-Weg 10, D-50829 Koln, Germany; tvon Leerodt Strasse 6a, D-52445 Titz, Germany; and bInstitute of Plant Biochemistry, Weinberg 3, D-06120 Halle, Germany Disease resistance of plants involves two distinct forms of chemical communication with the pathogen: recognition and defense. Both are essential components of a highly complex, multifaceted defense response, which begins with non-self recognition through the per- ception of pathogen~enved signal molecules and results in the production, inter alia, of antibiotically active compounds (phytoalex- ins) and cell wall-reinforcing matenal around the infection site. To elucidate the molecular details and the genomic basis of the under- lying chains of events, we used two different experimental systems: suspension~ultured cells of Petrose/inum crispum (parsley) and wild- type as well as mutant planu of Arabidopsis thaliana. Particular emphasis was placed on the structural and functional identification of signal and defense molecules, and on the mechanisms of signal perception, intracellular signal transduction and transcriptional r~ programming, including the structural and functional characteriza- tion of the responsible cis-acting gene promoter elements and trans- acting regulatory proteins. Comparing P. aispum and A. thaliana allows us to distinguish species-specific defense mechanisms from more universal responses, and furthermore provides general insigh~ into the nature of the interactions. Despite the complexity of the pathogen defense response, it is experimentallytractable, and knowl- edge gained so far has opened up a new realm of gene technology- assisted strategies for resistance breeding of crop plan~. Most plant/pathogen interactions are fierce battles of attack and counterattack. These battles are fought with highly sophisticated means for the survival of the individual and, in the end, of the entire population or species. On the plant side, the most immediate defense response includes the reprogramming of cellular metabolism and highly dynamic, structural rearrange- ments within and around the attacked cells. In the cases of locally invading, fungal or fungus-like pathogens, the counterstroke of the plant commences in a highly localized fashion with the perception of chemical and physical signals from the intruder and ends with the accumulation of soluble, antibiotically active compounds and wall-bound, barrier-forming substances. The initiating event, attempted penetration of a potential pathogen, immediately activates an elaborate safe-guard system of non-self recognition based on specifically adapted plant receptors. These receptors recognize characteristic pathogen-borne surface mol- ecules and transduce that information to numerous genes through a network of intracellular signaling cascades that or- chestrate an extensive, defense-oriented transcriptional repro- gramming of the affected cell. Among the major changes in cellular metabolism is the rapid accumulation of various sec- ondary metabolites, some of which are likely to be integral to the complex, multicomponent defense response. This network of events, from the initial stage of recognition by the plant to the successful confinement or death of the pathogen, www.pnas.org/cgi/doi/10. 1 073/pnas.0831 246100 is far too fine-meshed to be elucidated by using one single exper- imental system. For our investigations of a few selected key events, we have used two complementary model systems: suspension- cultured Petroselinum cnspum (parsley) cells and Arabidopsis thali- ana plants. Cells and protoplasts of P. crispum proved to be ideal tools for analyzing the cell biology, biochemistry, and molecular biology of the defense response. Wild-type and mutant A. thalu~na plants were particularly suited for transgenic studies and for inves- tigating def~ed host plant/pathogen interactions in combination with the plant genetic background. Overlaps at certain focal points enabled us to directly compare these two systems and to infer both species-specific and universal defense mechanisms. In both exper- imental systems, our analyses of secondary metabolites encom- passed aromatic phenylpropanoid as well as indolic compounds, among which antibiotically active phytoalexins and physicochemi- cally active barrier-forming substances were of particular interest. Here, we combine an overview of earlier findings with data obtained from recent experiments specifically designed to facilitate an interspecies comparison, a summary of the general principles observable so far, and a brief outline of one possible strategy for practical application of the results in crop plant breeding. From Elicitor Perception to Secondary Metabolite Accumulation Introductory Overview. The use of cultured P. crispum cells as our preferred experimental system for molecular and cell biological analyses offers several major advantages. First, the exogenously applied, pathogen-derived signal molecule is a chemically defimed, small, and highly specific peptide elicitor that enables detailed structural aIId functional analyses based on specially desi~ed synthetic modifications. Second, protoplasts denved from these cells retain full elicitor responsiveness and hence are a particularly valuable tool for analyzing gene promoter elements and their transcriptional regulators by using a simple and highly reproducible transfection and transient expression assay. Third, the pynchronous elicitation of cultured cells, in sharp contrast to the largely a~n- chronous infections of whole-plant tissue, enables the precise determination of temporal gene expression charactenstics. Fur- thermore, most, if not all, of the readily identifiable, elicitor- induced, soluble end wall-bound aromatic metabolites in P. crispum This paper results from the Arthur M. Sackier Colioquium of the National Academy of Sciences, "Chemical Communication in a Post-6enomic Worid," held January 17-19, 2003, at the Arnoid and Mabei Beckman Center of the Nationai Academies of Science and Engineering in Irvine, CA. Abbreviations: ACE, ACGT-containing element; bZIP, basic leucine zipper; 4CE, 4couma- rate:CoA iigase; ROS, reactive oxygen species; CMPG, cys/met/pro/gly; PAL phenylaianine ammonia-iyase; WRKY, trp/arg/iys/tyr. tTo whom correspondence should be addressed. E-maii: hahibroc~mpiz-koein.mpg.de. t3 2003 by The Nationai Academy of Sciences of the USA PNAS 1 November 25, 2003 1 vol. 100 1 suppl. 2 1 14569-14576

OCR for page 58
PATHOGEN chem./phys. attack cw nu ~c: H2O2 Am/ K+/~`CI- Secondary | Products I cy ~ :H2O2~ 0~? + - 3 ~ / Jasmonate ~ ? Defense-related genes ~ - ~ activation/inactivation|8 V~~ - PLANT chema/phys. defense Fig. 1. Schematic outline of early molecular responses of P. crispum cells to attempted penetration of a PhytopEthora some hypha. cw, cell wall; pm, plasma membrane; cy, cytoplasm; nu, nucleus. - are phenylpropanoid derivatives; that is, they are members of a single and well characterized class of compounds, in contrast to more heterogeneous chemical responses observed in many other systems, including A. thaliana. Fig. l schematically outlines the various extra- and intracellular events elucidated so far for the P. crispum system. These events extend from physical perception of the pathogen's infection hypha and chemical recognition of one highly active component of a putative mixture of pathogen-derived elicitors to transcriptional reprogramming of the cell's metabolic state and the consequential accumulation of defense-related, aromatic secondary compounds. All of the underlying cell biological experiments were conducted by using either P~tophthora some or P. infestans, two closely related pathogenic oomycetes to which P. crispum is nonhost resistant. For most of the molecular analyses, the live pathogen was replaced either with a chemical derivative (elicitor) or with a physical mimic (a sharp needle). As far as applicable to the largely undifferentiated, cultured cells or protoplasts, and as far as individual components have been analyzed, the response to elicitor was essentially the same as that observed with infected, whole-plant tissue, except for the additional occurrence of hypersensitive cell death at true infection sites. It should be noted ~ this connection that hypersensitive cell death, though not further investigated ir1 P. crispum, is probably among the most efficient defense responses in this and many other systems. Signal Perception. Even the earliest steps in the interaction between P. crispum and Phytophthora spp. are highly complex, but a few key events have been identified. After the formation of an appressonum as a tight physical holdfast, the pathogen develops an infection hypha in an attempt to invade the cell below (Fig. l). This hypha is likely to exert mechanical force during further growth and pene- tration by virtue of strong physical support from the appressonum, but at the same time exposes its surface to the plant's surveillance mechanism for non-self recognition. The mechanical interaction has been experimentally decoupled from chemical signaling by replacing the hypha with a needle mimic. Even a gentle touch with 14570 1 www.pnas.org/cgi/doi/10. 1 073/pnas.083 1246100 Table 1. Competitor activities of Pep13 analogs Peptide sequence Competitor activity, % VWNQPVRGFKVYE ( Pepl 3 ) QPVRGFKVYE VWLLPVRGFKVYE VWNEPVRGFKVYE VWNAQPVRGFKVYE VWNAAAQPVRGFKVYE VWQPVRGFKVYE 100 8 o 1 2 5 o Competitor activities using the standard binding assay (2) are given in percent of Pep13. Bold letters mark the essential W2 and P5 residues (2); underlining indicates amino acid substitutions or insertions. a tungsten needle induces several, though not all, of the reactions observed after elicitor treatment or true infections, including the activation of some defense-related genes and the migration of nucleus and cytoplasm toward the site of physical contact (14. In addition to pathogen-borne, exogenous elicitors, attacked plant cells are exposed to numerous breakdown products from their own damaged cell wall, some of which can also have significant roles in signal perception by synergistically acting as so-called endoge- nous elicitors. We speculate that the overall composition of the respective mixture of elicitor molecules enables the plant to activate the most appropriate defense response against a particular type of attacking pathogen. However, this facet has not been conclusively demonstrated in any pathosystem. Isolation and purification to homogeneity of the most elicitor- active component from the culture filtrate of Phytophthora some yielded a 42-kDa glycoprotein containing an oligopeptide of 13 aa (Pepl3) that in pure form is necessary and sufficient to stimulate the same complex defense response as observed either with a crude elicitor preparation or with the live pathogen (2~. Elicitor activity of Pepl3 is not restricted to P. crispum and leads, for example, to PR gene activation in cultured cells or leaves of potato ( OCR for page 59
3 h 4 h 5 h Fig. 2. Progressive elevation of the Ca2+ level in PhytopEthora sojee-infected P. crispum cells. Hyphal penetration sites (ps) were identified under white light (Am; Fluo4 fluorescence was visualized under blue light ( - F). Time points are given in hours postinoculation. (Bar = 100,um.) plant receptor for non-self recognition arose during evolution of this defense response. Some oomycete species, including Phytophthora some, possess not only the Pepl3-containing transglutaminase, but also a 24-kDa cell-wall protein, necrosis-inducing Phytophthora protein 1 (NPP1), that elicits a defense response in P. crispum cells very similar to that observed with Pepl3 (4~. Unlike Pepl3, however, NPP1 addition- ally induces the formation of hypersensitive cell death-like lesions In various dicotyledonous plants, including P. crzspum and A. thaliana. In P. crispum, the NPP1-mediated defense response does not involve the Pepl3 receptor, but employs all of the other signaling components involved in the Pepl3-triggered response (Fig. 1), suggesting an early convergence of the two elicitation pathways. It is presently open whether simultaneous recognition of both elicitors leads to synergistic effects. Signal Transduction. Receptor-mediated influx of extracellular Ca2+ is among the first detectable responses of P. crispum cells to treatment with either Pepl3 or elicitor-active derivatives thereof (2~. This Ca2+ influx is conducted in part by a novel type of Pepl3-responsive, plasma membrane-associated ion channel, the activation of which is a prerequisite for the triggering of all subsequent responses (5, 6~. Previous results demonstrating the rapid elevation of the cytoplasmic free Ca2+ level in elicitor- stimulated cells by using the bioluminescent Ca2+ indicator, apoae- quorin (6), have now been extended by monitoring the spatial progression of intracellular Ca2+ accumulation in the course of the infection process. By using the indicator dye Fluo-4, we could demonstrate a rapid, strong elevation of the Ca2+ level that progressed steadily within a few hours from the initial site of hyphal penetration throughout the entire cell (Fig. 2) and remained high for a prolonged period, as with the measurements using apoae- quorin (6~. Besides concomitant, functionally unresolved increases in several other ion fluxes (Fig. 1), two additional plasma mem- brane-associated, Ca2+ influx-dependent, defense-related events occur more or less simultaneously with the onset of Ca2+ accumu- lation: the generation of reactive oxygen species (ROS) and jas- monate (2, 7~. Among these multiple elicitor-induced events within the plasma membrane, the elevated Ca2+ and ROS levels are of particular relevance for the subsequent intracellular signal transduction to the nucleus. However, although both of them are potent mediators of defense-related gene activation, they affect, at least in part, differ- ent sets of target genes. One cytoplasmic signaling pathway leads from Ca2+ via the activation of at least three mitogen-activated Hahlbrock et a/. protein kineses to strong increases in PR gene expression, whereas another ROS-related pathway triggers the activation of phenylpro- panoid-biosynthetic genes and thus the induction of the various aromatic compounds to be discussed below (5, 7~. These observa- tions indicate the involvement of at least two distinct signaling cascades, one ROS-dependent and the other ROS-independent, in defense-related gene activation in P. crzspum. By contrast, the molecular targetts) of a third Pepl3-stimulated cascade, the jas- monate pathway (Fig. 1), are still elusive. In cultured P. crispum cells, pharmacological inhibitors of Pepl3-induced jasmonate ac- cumulation did not impair phytoalexin production or PR gene activation (7~. Targets of Intracellular Signaling. I~he cell culture system has re- vealed at least three major targets of the intracellular signaling pathways: extensive transcriptional reprogramming of the affected cell from "normal" to defense-oriented metabolism (8, 9~; reorga- nization of the cytoskeleton and translocation of the nucleus, together with a sizable portion of the cytoplasm, to the penetration site (10~; and extracellular conversion and extension of the signaling both to locally confined areas around the infection site (10, 11) and systemically throughout the entire affected organ or even the whole organism. In this latter regard, however, only c*cumstantial evi- dence exists so far in P. crispum. Among these multiple targets, the two focal points of our studies are the phenomenon of metabolic reprogramming, particularly the mechanisms of defense-related gene activation and inactivation, and the nature and function of the subsequently accumulating aromatic metabolites. Treatment of cultured P. crispum cells with the Phytophthora sojue-derived peptide elicitor (either Pepl3 or Pep25, an equally effective, slightly longer version; re£ 2) leads to rapid transcriptional activation (8) or repression (12) of at least several dozens of genes. Although gene repression is mechanistically as well as metabolically as interesting a phenomenon as is gene activation, our investigations have been focused mainly on the latter, largely because most of the genes analyzed so far in relation to aromatic secondary metabolism are strongly activated by elicitor. Three major outcomes of these studies are particularly noteworthy: the identification of several distinct classes of elicitor-responsive, cis-acting gene promoter elements; the discovery of two new families of regulatory proteins, the trp/arg/lys/tyr (WRKY) (13) and cys/met/pro/gly (CMPG) (14) protein families; and the demonstration of a few cases of exceptionally rapid, immediate-early gene activation, commencing within minutes after elicitor application and thereby possibly re- vealing immediate target genes of the elicitor-induced, intracellular signaling (13, 14). In the work summarized up to this point, our studies had been conducted with suspension-cultured P. crispum cells or protoplasts. By contrast, most of the analyses discussed in the following para- graphs were a combination of initiating studies using the cell culture system and subsequent, often more extensive, genome- and mutant- based investigations withA. thaliana plants. Because of this sequen- tial approach, most of the basic new discoveries were made in P. crispum, whereas more general insight was gained by including A. thaliana. Cis-Acting Promoter Elements. Several elicitor-responsive, cis-acting elements were first identified on P. crispum gene promoters and then served as starting points for comparative, more extensive analyses using the fully sequenced genome of A. thaliana. Equally important was the essential role of these elements in the identifi- cation of cognate binding proteins, again initially in P. crispum and then in A. thaliana. The first major finding was the discovery of a set of three almost invanably cooccurring elements specifically on the promoters of phenylpropanoid-biosynthetic genes. This set (boxes P, A, and L) was initially identified on the PcPAL1 gene by "in vivo footprinting" and has since been shown to occur on every newly discovered phenylalanine ammonia-lyase (PAL) gene (with PNAS I November25, 2003 1 vol. 100 1 suppl. 2 1 14571

OCR for page 60
A. PcPAL 1 -Pit ~~-CTCCAACAAACCC... . ~ ~ . A ~ : ~ : ~ .COGTCC L ~ ~ . TCTCACCTACC: P. caspum PcELI7 S CAGCCACCAAAGAGGACCCAGAAT : : : : PcPR2 ~ : :D ~~ ~~ TACAATTCAAACATTGTTGAAACAAGGAACC . :PcP~ R 1 ~ W1 ~ ~~ CTTAATTTGA£CGAGTA W:2 TCAAAGTTGkCCAATAA ,_. ~~ :. ~ . , :. , . . ~ ~YV3 TTTATTATGaCTAAATAGTCAG i, .~ ~ ~- ~ . . . I- :: ~ ~ .... ~ . ~ ~ ~ PcWRI OCR for page 61
WRKY At29O4880 . At5956270 . At29O3340 . · At1913960 . At1955600 . At4g 12020 At4926640 . · At2930250 . · At59O7 100 At4930930 · At2938470 . At4926440 At2937260 . ~ At39O1970 . · At39O1080 AV526908 ·~ ¢0C:~ · At4931800 · At1980840 · At2925000 1- P6W~ · At1962300 At 1968150 · At4922070 At1 969810 · At49O4450 · At49O1720 At1918860 · AtSa1S130 At5946350 AC003672 At49394 10 · At2947260 At594 1 570 · At4g1 8170 At2946 1 3Q · At5949520 At5943290 · At5926170 · At5g64810 At1 964000 At1 969310 · At2g21900 At3962340 At1 929860 · AtSp 13080 · At4924240 · At4931550 ~ At2923320 · At2g24570 · At2930590 · At39O4670 AtSq28650 '-~"'.~k~ OCR for page 62
E1 7-27 TCAATATGTCAATGGTC^ACATTCAAC E17-21 m4 TOT - TGGTCAACATTCAAC E17-21m11 TGTCA~TGGT0AACATTCAAC C~1 Cx1 N ~1 1 1 1 1 ~ J C: L1J co ID .~: :~ ~.~ ~.~.~. it, . ~ .~..~. Lo - .~.~ i _ - . ~~.~-~ .~ Fig. 7. Gel-shiTt assay indicating widely differing affinities of a few selected W box~ontaining elementsforWRKY11, a selected memberoftheWRKYfamily of cognate DNA-binding proteins. Procedures for heterologous expression and purification of the protein (25) and for gel-shift analysis (13) were followed essential ly as descri bed. DNA probes E 17-2 1 , 4CL4, and F were those shown in Fig. 3. For probes E17-27 and E17-21m, see ref. 14. Under these conditions, neither CMPG1 or WRKY1 mRNA (as measured 30 min after elicitor addition) nor PAL activity (huh time point), nor any of the soluble or wall-bound elicitor-inducible compounds listed in Fig. 6 (huh time point), accumulated signif- icantly above the O-h control level. Although these results do not demonstrate direct causal connections between any two of the items analyzed, they clearly indicate that in each case induction is the result of transcriptional activation of the responsible genets), for the immediate-early induced mRNAs as well as for PAL activity (the first committed step in phenylpropanoid biosynthesis) and for the various metabolic end products. Thus, we can exclude the theoretical possibility that at least some of the monitored effects were caused by transcription-independent mechanisms, an alter- native that might, for example, occur in the form of secondary product synthesis by liberation and/or conversion of preformed intermediates. However, we cannot exclude relatively minor but possibly relevant contributions from such sources. The second approach concerns the extent to which the numerous structural variants of cis-acting elements interact with different members of the large families of cognate binding proteins. This is a difficult question to answer conclusively for the situation in vivo. However, some of the available in vitro assays can give at least valuable hints in this direction. A sensitive tool for determining DNA-protein binding affinities is the analysis of band shifts caused by protein binding of DNA probes on electrophoretic mobility gels. Fig. 7 shows that a few structurally widely different, elicitor- responsive, W box-containing elements, including E17 from PrCMPG1, F from AtCMPGl, and three less precisely defined promoter regions fromAt4CL4 exhibit distinct binding affinities for one selected WRKY protein, AtWR;KY11. Importantly, however, nearly all of these elements are bound more or less efficiently by this particular family member. Considering the large size of the WRKY family of W box-binding proteins and the large number of potential W box-containing sequences and sequence arrangements, this result indicates a vast regulatory potential founded in an almost 14574 1 www.pnas.org/cgi/doi/10.1073/pnas.0831246100 Hierarchical structure of pathogen defense in plants Triggered by non-self recognition, executed by interconnected signalling cascades and superimposed by highly dynamic intracellular rearrangements Universal strategy Step-wise progression from highly localized to systemic defense Multiple functional components Papilla formation; hypersensitive cell death, phytoalexin accumulation; 'systemic acquired resistance' Regulatory motifs/Metabolic pathways Cis-acting elements; regulatory proteins; defense related pathways Genes/mRNAs/Proteins/Metabolites Species-specific structural and functional elements and pathway characteristics Fig. 8. Complexity pyramid illustrating the hierarchical organization and mod- ular structure of the pathogen defense response in higher plants. Note that the examples used to explain the pivotal role of the two central levels of the pyramid in the gradual upward progression from the particularto the universal (26) are an incomplete selection from the modules discussed in the text. infinite number of possible combinatorial permutations. Particu- larly relevant with regard to our goal to identify possible causal connections, it is apparent that any given W box-containing se- quence has a high potential to bind with a certain affinity to any given WRKY protein, implicating a similarly wide range of func- tional relationships in vivo. The third case exemplifies one of~the most promising and powerful techniques available for the analysis of causal connections: the employment of defined mutants. Among the large and rapidly growing number of A. thaliana knockout mutants, many have been functionally associated with defined steps in defense-related sig- naling or secondary product formation, or more generally, with the disease resistance phenotype. A presently incomplete analysis employing several such mutants is expected to add substantially to our understanding of the network of defense-related metabolic interconnections. Pathogen Defense in Plants: Paradigm of Structural and Functional Complexity At each of the levels investigated, the plant's response to pathogen attack represents a paradigm of biological complexity (9~. In addition to the complexity within each individual meta- bolic level, a hierarchically superimposed complexity pyramid emerges as the contours of the overall picture come into focus (Fig. 8~. In accord with the notion of a complexity pyramid "from the particular to the universal" (26), our results point to at least three, possibly four distinct levels of hierarchical orga- nization. At the top of the pyramid, one universal, multicom- ponent defense strategy governs several more or less universal, functional modules. Together with the various regulatory motifs and defense-related pathways at the upper and lower central levels of the pyramid, respectively, these modules mediate, coordinate, and execute the strategic response, whereas the bottom harbors the numerous individual, species-specific, de- fense-related genes and their products. Universal Defense Strategy. In P. crispum,A. thaliana, and all other systems analyzed to date, the overall defense response consists of a series of sequentially activated defense measures. These proceed from the highly localized to the less highly localized and finally to the systemic, with an optional termination of the process at certain stages when pathogen confinement has been achieved. Among the most intensely investigated components of this response are the papilla formed around the site of attempted penetration; the highly localized, hypersensitive death of the immediately affected cell; the Hahlbrock et a/.

OCR for page 63
local accumulation of antibiotically active substances, including H2O: and phytoalexins; and the systemic accumulation of hydro- lytic enzymes, such as glucanase and chitinase. This strictly ordered, temporally, spatially, and functionally modular defense strategy entails dramatic intracellular rearrangements (10) concomitant with the onset of transcriptional reprogramming at the infection site. However, the individual functional modules are probably not fully autonomous, but rather interconnected, and in some cases they may even partially overlap. Obvious examples of such metabolic or regulatory overlaps are the various interrelated responses to elicitor stimulation within the plasma membrane; the dual or even manifold roles of Ca2+ in intracellular regulation; the role of H202 both as a toxic agent and in cell-wall cross-linking; and the initial, common steps in the biosynthesis of phenylalanine-derived phytoalexins and cell wall-bound compounds. Even though the mechanistic details of such interconnections are presently obscure, the overall response of the plant reveals that they exist. Regulatory Motifs and Transcription Factor Families. Both the per- ception of pathogen-derived elicitors and its subsequent intracel- lular signal transduction employ basic mechanisms that annear to be universal not only in higher plants, but also, at least to a considerable extent, in higher animals (27), suggesting a common evolutionary origin of the general defense strategy throughout all higher eukaryotes. Numerous, more or less directly defense-related genes are major targets of two of the intracellular signal transduction chains In P. crcspum (Fig. 1~. Probably all of them contain at least one of a small number of basic types of elicitor-response element, two of which (containing either the W box or the P/A/L set of boxes) occur most frequently on these genes throughout all plants examined. Remark- ably, the P/A/L box-containing element has so far been found on all genes encoding functionally identified or putative phenylpro- panoid-biosynthetic enzymes. Moreover, these genes share, at least in P. crispum, two additional, remarkable features: they are acti- vated by the Ca2+/O2-dependent signaling pathway, and the mRNA accumulation patterns follow identical time courses for all P/A/L-containing genes, in sharp contrast to the uncoordinated behavior of nearly all other elicitor-responsive genes analyzed (8~. Most probably, these three common features are causally con- nected. Whether this extends to the cognate DNA-binding proteins remains to be seen. It presently appears doubtful whether a similar close metabolic relationship exists among the large number of genes bearing W box-containing promoters. The W box is not only by far the most frequently occurring structural element of elicitor-response ele- ments in plants, but is also notorious for its challenging diversity of closely spaced repetitions and/or combinations with other se- quences. In such cases, at least one W box is usually essential for conveying the elicitor response, and certain types of repeat struc- ture have been associated with immediate-early gene activation (14, 17, 19~. Fig. 7 exemplifies the broad range of binding affinities exerted by just a few structurally distinct representatives of such W-box arrangements toward one selected member of the WRKY family of transcriptional regulators. This sample includes three W box-containing fragments from the At4CL4 gene promoter, the only presently known case in A. thalazna where W boxes cooccur with the characteristic P/A/L-box set on phenylpropanoid- biosynthetic genes. The recently identified At4CL4 gene encodes a rare isoform of 4-coumarate:CoA ligase (4CL) with unusual sub- strate specificity and may therefore have an exceptional metabolic function and atypical expression mode. Here, the W-box regions from the At4CL4 promoter were used to test binding strength toward WRKY proteins, as predicted from sequence relationships with previously analyzed elements. The results substantiate these predictions and furthermore reveal a large influence of the sur- Hahlbrock et a/. rounding sequence on the binding affinity of W box-containing elements. Although much less is known about the S and D elements, their identification as strong elicitor-responsive elements indicates that the diversity of such elements is by no means confined to those containing P/A/L and W boxes. A particularly interesting recent observation in this context was the repression by elicitor of previ- ously UV light-activated genes through a positively UV light- responsive and negatively elicitor-responsive ACE/ACE element combination, as manifested in the PeACO promoter fragment shown in Fig. SA. This inverse response of one promoter element to different kinds of stress is yet another example of the complexity and connectivity of regulatory circuits, including the possible in- volvement of the same family of DNA-binding proteins in both up and down-regulation of genes (12~. Taken together, these results reveal a modularity even at the level of elicitor-responsive gene promoters, with W box- and (metabol- ically more confined) P/A/L box-containing elements being the most abundant, universally occurring representatives. Recurrent modularity in the fine structure of these basic building blocks at the species and gene levels generates uniqueness and biological spec- ificity. This principle also applies to the cognate DNA-binding proteins and to the peripheral transcriptional regulators. Just as with cis-acting elements, a few distinct classes of transacting factors, each occurring as structurally diversified families, yield discrete but universal modules. Thus, the number of functional combinations for these modules, amplified by homo- and heterodimeric forms, may parallel the number of physiological challenges to which the plant must respond. Binding of a regulatory protein complex is required for inacti- vation as well as for activation of a gene. Although the mechanisms of gene inactivation have been studied much less extensively than those of gene activation, it is unlikely that they fundamentally differ. Some of our results require us to presume that it may be the combination of isoforms of a given transcription factor family that changes with up- or down-regulation of a particular gene, whereas the basic type remains unchanged (12~. Metabolic Pathways and Aromatic Secondary Products. A ramified dimension of complexity is reached at the level of secondary plant metabolism. In contrast to the cis-acting elements and transacting factors, many secondary metabolic pathways are unique to certain plant genera, families or even species, and most of them are species-specific at least with regard to the specified composition of the respective product bouquet. Accordingly, all major soluble, elicitor- or pathogen-induced aromatic compounds in P. crispum are species-specific mixtures of differently substituted phenylpro- panoid derivatives, whereas in A. thaliana they are exclusively indolic intermediates or end products. It is therefore all the more surprising that, with the exception of one or two indolic compounds in A. thaliana, all major induced cell-wall constituents are similar or identical phenylpropanoids in these two and several other species. Two alternat*es seem equally plausible: either there is greater evolutionary pressure on the conservation of the cell wall-bound compounds or this branch of phenylpropanoid metabolism, whether it has a common evolution- ary origin in all plants or has converged from multiple origins, has limited degrees of chemical freedom, in contrast to the various pathways generating phytoalexins that have evolved a greater chemical diversity. Although phytoalexin production and cell-wall reinforcement with phenylpropanoid derivatives can be regarded as two independent functional modules occupying parallel hierarchi- cal positions within the overall defense strategy, their species- specific patterns of diversity could not differ more. Practical Applications Our motivation for these investigations has been two-fold: fascina- tion with an exciting combination of molecular, cellular, and PNAS I November25, 2003 1 vol. 100 1 suppl. 2 1 14575

OCR for page 64
ecologically oriented research and the coupling of this excitement with the expectation that scientific discoveries would reveal new approaches to breeding disease resistance in crop plants. To reach this level of practical application, two requirements had to be fulfilled. First, the basic principles of pathogen defense in plants had to be understood. We suppose that this stage has been reached with sufficient clarity, despite many remaining gaps in our knowledge about the underlying mechanisms. Second, a biologically meaning- ful, heritable, crop plant-adapted strategy must be feasible in every respect, including physiological tolerance by the plant and accep- tance by the public. Comparing the largely unexplored efficiency and overwhelming diversity of chemical defense, particularly the difficulty in pinpointing individual, universally applicable (physio- logically tolerable as well as consumer-friendly) defense-related compounds, with the proven high efficiency of hypersensitive cell death as a defense mechanism, we decided on probing a new gene technology-based strategy in the latter direction. Our strategy employs the recently identified, rapidly, strongly, locally, and specifically elicitor-responsive promoter elements (Fig. 3), either alone or in combinations, for example in conjunction with a gene encoding a cell death-conferring principle, such as a broadly acting ribonuclease (28~. Transcriptional activation of such a con- struct on infection of a transgenic plant would cause or intensify hypersensitive suicidal death of the affected cell, and thus confer or augment a particularly efficient defense mechanism. A first suc- cessful proof of principle has demonstrated the feasibility of this strategy (28~. However, further improvements will be necessary to adapt various details to the special needs of crop plant breeding. For example, strict avoidance of unspecific transgene expression in response to exogenous stimuli other than infections, or to endog- enous effecters during plant development, is absolutely essential. This is by no means a trivial obstacle, because most infection- responsive genes also respond to wounding and other stresses, and, 1. Gus-Mayer, S., Naton, B., Hahlbrock, K. & Schmelzer, E. (1998) Proc. Natl. Acad. Sci. USA 95, 8398-8403. 2. Nurnberger, T., Nennstiel, D., Jabs, T., Sacks, W. R., Hahlbrock, K. & Scheel, D. (1994) Cell 78, 449-460. 3. Brunner, F., Rosahl, S., Lee, J., Rudd, J. J., Geiler, C., Kauppinen, S., Ras- mussen, G., Scheel, D. & Nurnberger, T. (2002) EMBO J. 21, 6681-6688. 4. Fellbrich, G., Romanski, A., Varet, A., Blume, B., Brunner, F., Engelhardt, S., Felix, G., Kemmerling, B., Krzymowska, M. & Nurnberger, T. (2002) Plant J. 32, 1-16. 5. Scheel, D. (1998) Curr. Opin. Plant Biol. 1, 305-310. 6. Blume, B., Nurnberger, T., Nass, N. & Scheel, D. (2000) Plant Cell 12, 1425-1440. 7. Kroj, T., Rudd, J. J., Nurnberger, T., Gabler, Y., Lee, J. & Scheel, D. (2003) J. Biol. Chem. 278, 2256-2264. 8. Batz, O., Logemann, E., Reinold, S. & Hahlbrock, K. (1998) Biol. Chem. 379, 1127-1 135. 9. Somssich, I. E. & Hahlbrock, K. (1998) Trends Plant Sci. 3, 86-90. 10. Gross, P., Julius, C., Schmelzer, E. & Hahlbrock, K. (1993) EMBO J. 12, 1735-1744. 11. Schmelzer, E., Kruger-Lebus, S. & Hahlbrock, K. (1989) Plant Cell 1, 993-1001. 12. Logemann, E. & Hahlbrock, K. (2001) Proc. Natl. Acad. Sci. USA 99, 2428-2432. 13. Rushton, P. J., Tovar Torres, J. T., Parniske, M., Wernert, P., Hahlbrock, K. & Somssich, I. E. (1996) EMBO J. 15, 5690-5700. 14. Kirsch, C., Logemann, E., Lippok, B., Schmelzer, E. & Hahlbrock, K. (2001) Plant J. 26, 217-227. 15. Hahlbrock, K., Scheel, D., Logemann, E., Nurnberger, T., Parniske, M., 14576 1 www.pnas.org/cgi/doi/10.1073/pnas.0831246100 in addition, are expressed during certain stages of development, such as flowering, senescence or root-tip growth. Some of the promoter elements listed in Fig. 3, notably E17 and F. are exceptionally specific in their response to infections (14, 19) and hence may be particularly well suited for the design of artificial defense mechanisms. Recently published (16) as well as unpublished data (A.H.) on the specifics of promoter design and expression modes are aimed at broadening the basis for further improvements of this strategy, including its sophistica- tion in detail. In the long term, for this or any other strategy for breeding disease resistance, multigenic traits will have to be introduced that are not easily overcome by mutations in the pathogens. Conclusions The combination of a universal strategy with an almost infinite number of species-specific variations of the pathogen defense response in plants ideally illustrates the interplay of conceptual richness, metabolic options, physiological constraints and eco- logical demands within which evolution takes place. Hierarchical subdivision of the overall response into multiple functional modules is executed by interconnected, partly universal, partly species-specific signaling pathways that together mediate an extensive, rapid transcriptional reprogramming of exclusively species-specific genes. A few large, highly diversified families of cis-acting elements and transacting factors are the pivotal links between the particular and the universal. The potential for fine tuning through combinatorial permutations accounts for the remarkable interspecies functionality of these elements and their cognate factors in transgenic plants and impels their use in new strategies of crop plant breeding for an environmentally safe disease management. We thank Dr. Bill Martin, Dusseldorf, Germany, and Dr. Dierk Scheel, Halle, Germany, for valuable comments on the manuscript. Reinold, S., Sacks, W. R. & Schmelzer, E. (1995) Proc. Natl. Acad. Sci. USA 92, 4150-41S7. 16. Rushton, P. J., Rheinstadler, A., Lipka, V., Lippok, B. & Somssich, I. E. (2002) Plant Cell 14, 749-762. 17. Eulgem, T., Rushton, P. J., Schmelzer, E., Hahlbrock, K. & Somssich, I. E. (1999) EMBO J. 18, 4689-4699. 18. Weisshaar, B., Armstrong, G. A., Block, A., da Costa e Silva, O. & Hahlbrock, K. (1991) EMBO J. 10, 1777-1786. 19. Heise, A., Lippok, B., Kirsch, C. & Hahlbrock, K. (2002) Proc. Natl. Acad. Sci. USA 99, 9049-9054. 20. Eulgem, T., Rushton, P. J., Robatzek, S. & Somssich, I. E. (2000) Trends Plant Sci. 5, 199-206. 21. Jakoby, M., Droege-Laser, W., Kroj, T., Tiedemann, J., Vicente-Carbajosa, J., Weisshaar, B. & Parcy, F. (2002) Trends Plant Sci. 7, 106-111. 22. Chen, W., Provart, N. J., Glazebrook, J., Katagiri, F., Chang, [I.-S., Eulgem, T., Mauch, F., Luan, S., Zou, G., Whitham, S. A., et al. (2002) Plant Cell 14, 559-574. 23. Hagemeier, J., Batz, O., Schmidt, J., Wray, V., Hahlbrock, K. & Strack, D. (1999) Phytochemistry 51, 629-635. 24. Hagemeier, J., Schneider, B., Oldham, N. J. & Hahlbrock, K. (2001) Proc. Natl. Acad. Sci. USA 98, 753-758. 25. Maeo, K., Hayashi, S., Kojima-Suzuki, H., Morikami, A. & Nakamura, K. (2001) Biosci. Biotechnol. Biochem. 65, 2428-2436. 26. Oltvai, Z. N. & Barabasi, A.-L. (2002) Scierlce 298, 763-764. 27. Nurnberger, T. & Brunner, F. (2002) Curr. Opin. Plant B'ol. 5, 318-324. 28. Strittmatter, G., Janssens, J., Opsomer, C. & Botterman, J. (1995) Bio/Technology 13, 1085-1089. Hahlbrock et a/.

Representative terms from entire chapter:

gene activation