|
Items in cart [0] |
Questions? Call 888-624-8373 |
| Copyright © 2009. National Academy of Sciences. All rights reserved. Terms of Use and Privacy Statement |
Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter.
Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.
Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.
OCR for page 57
Colloquium
Non-seIf recognition, transcriptional reprogramming,
and secondary metabo~ite accumulation during
plant/pathogen interactions
Klaus Hahlbrock*t, Pawel Bednarek*, Ingo Ciolkowski*, Bjorn Hamberger*, Andreas Heise*, Hiltrud Liedgenst,
El ke Logemann *, Thorsten Nurnberger§, Elmon Schmeizer*, Imre E. Somssich*, and Jianwen Tan*
*Max-Planck-lnstitut fur Zuchtungsforschung, Carl-von-Linne-Weg 10, D-50829 Koln, Germany; tvon Leerodt Strasse 6a, D-52445 Titz, Germany; and
bInstitute of Plant Biochemistry, Weinberg 3, D-06120 Halle, Germany
Disease resistance of plants involves two distinct forms of chemical
communication with the pathogen: recognition and defense. Both are
essential components of a highly complex, multifaceted defense
response, which begins with non-self recognition through the per-
ception of pathogen~enved signal molecules and results in the
production, inter alia, of antibiotically active compounds (phytoalex-
ins) and cell wall-reinforcing matenal around the infection site. To
elucidate the molecular details and the genomic basis of the under-
lying chains of events, we used two different experimental systems:
suspension~ultured cells of Petrose/inum crispum (parsley) and wild-
type as well as mutant planu of Arabidopsis thaliana. Particular
emphasis was placed on the structural and functional identification of
signal and defense molecules, and on the mechanisms of signal
perception, intracellular signal transduction and transcriptional r~
programming, including the structural and functional characteriza-
tion of the responsible cis-acting gene promoter elements and trans-
acting regulatory proteins. Comparing P. aispum and A. thaliana
allows us to distinguish species-specific defense mechanisms from
more universal responses, and furthermore provides general insigh~
into the nature of the interactions. Despite the complexity of the
pathogen defense response, it is experimentallytractable, and knowl-
edge gained so far has opened up a new realm of gene technology-
assisted strategies for resistance breeding of crop plan~.
Most plant/pathogen interactions are fierce battles of attack
and counterattack. These battles are fought with highly
sophisticated means for the survival of the individual and, in the
end, of the entire population or species. On the plant side, the
most immediate defense response includes the reprogramming
of cellular metabolism and highly dynamic, structural rearrange-
ments within and around the attacked cells. In the cases of locally
invading, fungal or fungus-like pathogens, the counterstroke of
the plant commences in a highly localized fashion with the
perception of chemical and physical signals from the intruder
and ends with the accumulation of soluble, antibiotically active
compounds and wall-bound, barrier-forming substances. The
initiating event, attempted penetration of a potential pathogen,
immediately activates an elaborate safe-guard system of non-self
recognition based on specifically adapted plant receptors. These
receptors recognize characteristic pathogen-borne surface mol-
ecules and transduce that information to numerous genes
through a network of intracellular signaling cascades that or-
chestrate an extensive, defense-oriented transcriptional repro-
gramming of the affected cell. Among the major changes in
cellular metabolism is the rapid accumulation of various sec-
ondary metabolites, some of which are likely to be integral to the
complex, multicomponent defense response.
This network of events, from the initial stage of recognition by
the plant to the successful confinement or death of the pathogen,
www.pnas.org/cgi/doi/10. 1 073/pnas.0831 246100
is far too fine-meshed to be elucidated by using one single exper-
imental system. For our investigations of a few selected key events,
we have used two complementary model systems: suspension-
cultured Petroselinum cnspum (parsley) cells and Arabidopsis thali-
ana plants. Cells and protoplasts of P. crispum proved to be ideal
tools for analyzing the cell biology, biochemistry, and molecular
biology of the defense response. Wild-type and mutant A. thalu~na
plants were particularly suited for transgenic studies and for inves-
tigating def~ed host plant/pathogen interactions in combination
with the plant genetic background. Overlaps at certain focal points
enabled us to directly compare these two systems and to infer both
species-specific and universal defense mechanisms. In both exper-
imental systems, our analyses of secondary metabolites encom-
passed aromatic phenylpropanoid as well as indolic compounds,
among which antibiotically active phytoalexins and physicochemi-
cally active barrier-forming substances were of particular interest.
Here, we combine an overview of earlier findings with data
obtained from recent experiments specifically designed to facilitate
an interspecies comparison, a summary of the general principles
observable so far, and a brief outline of one possible strategy for
practical application of the results in crop plant breeding.
From Elicitor Perception to Secondary Metabolite
Accumulation
Introductory Overview. The use of cultured P. crispum cells as our
preferred experimental system for molecular and cell biological
analyses offers several major advantages. First, the exogenously
applied, pathogen-derived signal molecule is a chemically defimed,
small, and highly specific peptide elicitor that enables detailed
structural aIId functional analyses based on specially desi~ed
synthetic modifications. Second, protoplasts denved from these
cells retain full elicitor responsiveness and hence are a particularly
valuable tool for analyzing gene promoter elements and their
transcriptional regulators by using a simple and highly reproducible
transfection and transient expression assay. Third, the pynchronous
elicitation of cultured cells, in sharp contrast to the largely a~n-
chronous infections of whole-plant tissue, enables the precise
determination of temporal gene expression charactenstics. Fur-
thermore, most, if not all, of the readily identifiable, elicitor-
induced, soluble end wall-bound aromatic metabolites in P. crispum
This paper results from the Arthur M. Sackier Colioquium of the National Academy of
Sciences, "Chemical Communication in a Post-6enomic Worid," held January 17-19, 2003,
at the Arnoid and Mabei Beckman Center of the Nationai Academies of Science and
Engineering in Irvine, CA.
Abbreviations: ACE, ACGT-containing element; bZIP, basic leucine zipper; 4CE, 4couma-
rate:CoA iigase; ROS, reactive oxygen species; CMPG, cys/met/pro/gly; PAL phenylaianine
ammonia-iyase; WRKY, trp/arg/iys/tyr.
tTo whom correspondence should be addressed. E-maii: hahibroc~mpiz-koein.mpg.de.
t3 2003 by The Nationai Academy of Sciences of the USA
PNAS 1 November 25, 2003 1 vol. 100 1 suppl. 2 1 14569-14576
OCR for page 58
OCR for page 60
OCR for page 63
OCR for page 64
Representative terms from entire chapter:
gene activation
PATHOGEN
chem./phys. attack
cw
nu ~c:
H2O2
Am/ K+/~`CI-
Secondary |
Products I
cy ~
:H2O2~
0~?
+
- 3 ~
/
Jasmonate
~ ?
Defense-related genes ~ - ~
activation/inactivation|8 V~~
-
PLANT
chema/phys. defense
Fig. 1. Schematic outline of early molecular responses of P. crispum cells to
attempted penetration of a PhytopEthora some hypha. cw, cell wall; pm, plasma
membrane; cy, cytoplasm; nu, nucleus.
-
are phenylpropanoid derivatives; that is, they are members of a
single and well characterized class of compounds, in contrast to
more heterogeneous chemical responses observed in many other
systems, including A. thaliana.
Fig. l schematically outlines the various extra- and intracellular
events elucidated so far for the P. crispum system. These events
extend from physical perception of the pathogen's infection hypha
and chemical recognition of one highly active component of a
putative mixture of pathogen-derived elicitors to transcriptional
reprogramming of the cell's metabolic state and the consequential
accumulation of defense-related, aromatic secondary compounds.
All of the underlying cell biological experiments were conducted by
using either P~tophthora some or P. infestans, two closely related
pathogenic oomycetes to which P. crispum is nonhost resistant. For
most of the molecular analyses, the live pathogen was replaced
either with a chemical derivative (elicitor) or with a physical mimic
(a sharp needle). As far as applicable to the largely undifferentiated,
cultured cells or protoplasts, and as far as individual components
have been analyzed, the response to elicitor was essentially the same
as that observed with infected, whole-plant tissue, except for the
additional occurrence of hypersensitive cell death at true infection
sites. It should be noted ~ this connection that hypersensitive cell
death, though not further investigated ir1 P. crispum, is probably
among the most efficient defense responses in this and many other
systems.
Signal Perception. Even the earliest steps in the interaction between
P. crispum and Phytophthora spp. are highly complex, but a few key
events have been identified. After the formation of an appressonum
as a tight physical holdfast, the pathogen develops an infection
hypha in an attempt to invade the cell below (Fig. l). This hypha is
likely to exert mechanical force during further growth and pene-
tration by virtue of strong physical support from the appressonum,
but at the same time exposes its surface to the plant's surveillance
mechanism for non-self recognition. The mechanical interaction
has been experimentally decoupled from chemical signaling by
replacing the hypha with a needle mimic. Even a gentle touch with
14570 1 www.pnas.org/cgi/doi/10. 1 073/pnas.083 1246100
Table 1. Competitor activities of Pep13 analogs
Peptide sequence
Competitor activity, %
VWNQPVRGFKVYE ( Pepl 3 )
QPVRGFKVYE
VWLLPVRGFKVYE
VWNEPVRGFKVYE
VWNAQPVRGFKVYE
VWNAAAQPVRGFKVYE
VWQPVRGFKVYE
100
8
o
1
2
5
o
Competitor activities using the standard binding assay (2) are given in
percent of Pep13. Bold letters mark the essential W2 and P5 residues (2);
underlining indicates amino acid substitutions or insertions.
a tungsten needle induces several, though not all, of the reactions
observed after elicitor treatment or true infections, including the
activation of some defense-related genes and the migration of
nucleus and cytoplasm toward the site of physical contact (14.
In addition to pathogen-borne, exogenous elicitors, attacked
plant cells are exposed to numerous breakdown products from their
own damaged cell wall, some of which can also have significant roles
in signal perception by synergistically acting as so-called endoge-
nous elicitors. We speculate that the overall composition of the
respective mixture of elicitor molecules enables the plant to activate
the most appropriate defense response against a particular type of
attacking pathogen. However, this facet has not been conclusively
demonstrated in any pathosystem.
Isolation and purification to homogeneity of the most elicitor-
active component from the culture filtrate of Phytophthora some
yielded a 42-kDa glycoprotein containing an oligopeptide of 13 aa
(Pepl3) that in pure form is necessary and sufficient to stimulate
the same complex defense response as observed either with a crude
elicitor preparation or with the live pathogen (2~. Elicitor activity of
Pepl3 is not restricted to P. crispum and leads, for example, to PR
gene activation in cultured cells or leaves of potato (
3 h
4 h
5 h
Fig. 2. Progressive elevation of the Ca2+ level in PhytopEthora sojee-infected
P. crispum cells. Hyphal penetration sites (ps) were identified under white light
(Am; Fluo4 fluorescence was visualized under blue light ( - F). Time points are
given in hours postinoculation. (Bar = 100,um.)
plant receptor for non-self recognition arose during evolution of
this defense response.
Some oomycete species, including Phytophthora some, possess not
only the Pepl3-containing transglutaminase, but also a 24-kDa
cell-wall protein, necrosis-inducing Phytophthora protein 1 (NPP1),
that elicits a defense response in P. crispum cells very similar to that
observed with Pepl3 (4~. Unlike Pepl3, however, NPP1 addition-
ally induces the formation of hypersensitive cell death-like lesions
In various dicotyledonous plants, including P. crzspum and A.
thaliana. In P. crispum, the NPP1-mediated defense response does
not involve the Pepl3 receptor, but employs all of the other
signaling components involved in the Pepl3-triggered response
(Fig. 1), suggesting an early convergence of the two elicitation
pathways. It is presently open whether simultaneous recognition of
both elicitors leads to synergistic effects.
Signal Transduction. Receptor-mediated influx of extracellular Ca2+
is among the first detectable responses of P. crispum cells to
treatment with either Pepl3 or elicitor-active derivatives thereof
(2~. This Ca2+ influx is conducted in part by a novel type of
Pepl3-responsive, plasma membrane-associated ion channel, the
activation of which is a prerequisite for the triggering of all
subsequent responses (5, 6~. Previous results demonstrating the
rapid elevation of the cytoplasmic free Ca2+ level in elicitor-
stimulated cells by using the bioluminescent Ca2+ indicator, apoae-
quorin (6), have now been extended by monitoring the spatial
progression of intracellular Ca2+ accumulation in the course of the
infection process. By using the indicator dye Fluo-4, we could
demonstrate a rapid, strong elevation of the Ca2+ level that
progressed steadily within a few hours from the initial site of hyphal
penetration throughout the entire cell (Fig. 2) and remained high
for a prolonged period, as with the measurements using apoae-
quorin (6~. Besides concomitant, functionally unresolved increases
in several other ion fluxes (Fig. 1), two additional plasma mem-
brane-associated, Ca2+ influx-dependent, defense-related events
occur more or less simultaneously with the onset of Ca2+ accumu-
lation: the generation of reactive oxygen species (ROS) and jas-
monate (2, 7~.
Among these multiple elicitor-induced events within the plasma
membrane, the elevated Ca2+ and ROS levels are of particular
relevance for the subsequent intracellular signal transduction to the
nucleus. However, although both of them are potent mediators of
defense-related gene activation, they affect, at least in part, differ-
ent sets of target genes. One cytoplasmic signaling pathway leads
from Ca2+ via the activation of at least three mitogen-activated
Hahlbrock et a/.
protein kineses to strong increases in PR gene expression, whereas
another ROS-related pathway triggers the activation of phenylpro-
panoid-biosynthetic genes and thus the induction of the various
aromatic compounds to be discussed below (5, 7~. These observa-
tions indicate the involvement of at least two distinct signaling
cascades, one ROS-dependent and the other ROS-independent, in
defense-related gene activation in P. crzspum. By contrast, the
molecular targetts) of a third Pepl3-stimulated cascade, the jas-
monate pathway (Fig. 1), are still elusive. In cultured P. crispum
cells, pharmacological inhibitors of Pepl3-induced jasmonate ac-
cumulation did not impair phytoalexin production or PR gene
activation (7~.
Targets of Intracellular Signaling. I~he cell culture system has re-
vealed at least three major targets of the intracellular signaling
pathways: extensive transcriptional reprogramming of the affected
cell from "normal" to defense-oriented metabolism (8, 9~; reorga-
nization of the cytoskeleton and translocation of the nucleus,
together with a sizable portion of the cytoplasm, to the penetration
site (10~; and extracellular conversion and extension of the signaling
both to locally confined areas around the infection site (10, 11) and
systemically throughout the entire affected organ or even the whole
organism. In this latter regard, however, only c*cumstantial evi-
dence exists so far in P. crispum. Among these multiple targets, the
two focal points of our studies are the phenomenon of metabolic
reprogramming, particularly the mechanisms of defense-related
gene activation and inactivation, and the nature and function of the
subsequently accumulating aromatic metabolites.
Treatment of cultured P. crispum cells with the Phytophthora
sojue-derived peptide elicitor (either Pepl3 or Pep25, an equally
effective, slightly longer version; re£ 2) leads to rapid transcriptional
activation (8) or repression (12) of at least several dozens of genes.
Although gene repression is mechanistically as well as metabolically
as interesting a phenomenon as is gene activation, our investigations
have been focused mainly on the latter, largely because most of the
genes analyzed so far in relation to aromatic secondary metabolism
are strongly activated by elicitor. Three major outcomes of these
studies are particularly noteworthy: the identification of several
distinct classes of elicitor-responsive, cis-acting gene promoter
elements; the discovery of two new families of regulatory proteins,
the trp/arg/lys/tyr (WRKY) (13) and cys/met/pro/gly (CMPG)
(14) protein families; and the demonstration of a few cases of
exceptionally rapid, immediate-early gene activation, commencing
within minutes after elicitor application and thereby possibly re-
vealing immediate target genes of the elicitor-induced, intracellular
signaling (13, 14).
In the work summarized up to this point, our studies had been
conducted with suspension-cultured P. crispum cells or protoplasts.
By contrast, most of the analyses discussed in the following para-
graphs were a combination of initiating studies using the cell culture
system and subsequent, often more extensive, genome- and mutant-
based investigations withA. thaliana plants. Because of this sequen-
tial approach, most of the basic new discoveries were made in P.
crispum, whereas more general insight was gained by including A.
thaliana.
Cis-Acting Promoter Elements. Several elicitor-responsive, cis-acting
elements were first identified on P. crispum gene promoters and
then served as starting points for comparative, more extensive
analyses using the fully sequenced genome of A. thaliana. Equally
important was the essential role of these elements in the identifi-
cation of cognate binding proteins, again initially in P. crispum and
then in A. thaliana. The first major finding was the discovery of a
set of three almost invanably cooccurring elements specifically on
the promoters of phenylpropanoid-biosynthetic genes. This set
(boxes P, A, and L) was initially identified on the PcPAL1 gene by
"in vivo footprinting" and has since been shown to occur on every
newly discovered phenylalanine ammonia-lyase (PAL) gene (with
PNAS I November25, 2003 1 vol. 100 1 suppl. 2 1 14571
A.
PcPAL 1
-Pit ~~-CTCCAACAAACCC...
. ~
~ .
A ~ : ~ : ~ .COGTCC
L ~ ~ . TCTCACCTACC:
P. caspum
PcELI7
S CAGCCACCAAAGAGGACCCAGAAT
: : :
:
PcPR2 ~ :
:D ~~ ~~ TACAATTCAAACATTGTTGAAACAAGGAACC
.
:PcP~ R 1 ~
W1 ~ ~~ CTTAATTTGA£CGAGTA
W:2 TCAAAGTTGkCCAATAA
,_. ~~ :. ~ . , :. , . . ~
~YV3 TTTATTATGaCTAAATAGTCAG
i, .~ ~ ~- ~ . . .
I- :: ~ ~ .... ~ . ~ ~ ~
PcWRI
WRKY
At29O4880 .
At5956270 .
At29O3340 .
· At1913960 .
At1955600 .
At4g 12020
At4926640 .
· At2930250 .
· At59O7 100
At4930930
· At2938470 .
At4926440
At2937260 .
~ At39O1970 .
· At39O1080
AV526908
·~
¢0C:~
· At4931800
· At1980840
· At2925000
1- P6W~
· At1962300
At 1968150
· At4922070
At1 969810
· At49O4450
· At49O1720
At1918860
· AtSa1S130
At5946350
AC003672
At49394 10
· At2947260
At594 1 570
· At4g1 8170
At2946 1 3Q
· At5949520
At5943290
· At5926170
· At5g64810
At1 964000
At1 969310
· At2g21900
At3962340
At1 929860
· AtSp 13080
· At4924240
· At4931550
~ At2923320
· At2g24570
· At2930590
· At39O4670
AtSq28650
'-~"'.~k~
E1 7-27 TCAATATGTCAATGGTC^ACATTCAAC
E17-21 m4 TOT - TGGTCAACATTCAAC
E17-21m11 TGTCA~TGGT0AACATTCAAC
C~1 Cx1 N ~1
1 1 1 1 ~
J
C:
L1J
co
ID
.~: :~ ~.~ ~.~.~.
it, . ~ .~..~.
Lo
- .~.~ i _ - . ~~.~-~ .~
Fig. 7. Gel-shiTt assay indicating widely differing affinities of a few selected W
box~ontaining elementsforWRKY11, a selected memberoftheWRKYfamily of
cognate DNA-binding proteins. Procedures for heterologous expression and
purification of the protein (25) and for gel-shift analysis (13) were followed
essential ly as descri bed. DNA probes E 17-2 1 , 4CL4, and F were those shown in Fig.
3. For probes E17-27 and E17-21m, see ref. 14.
Under these conditions, neither CMPG1 or WRKY1 mRNA (as
measured 30 min after elicitor addition) nor PAL activity (huh time
point), nor any of the soluble or wall-bound elicitor-inducible
compounds listed in Fig. 6 (huh time point), accumulated signif-
icantly above the O-h control level. Although these results do not
demonstrate direct causal connections between any two of the items
analyzed, they clearly indicate that in each case induction is the
result of transcriptional activation of the responsible genets), for
the immediate-early induced mRNAs as well as for PAL activity
(the first committed step in phenylpropanoid biosynthesis) and
for the various metabolic end products. Thus, we can exclude the
theoretical possibility that at least some of the monitored effects
were caused by transcription-independent mechanisms, an alter-
native that might, for example, occur in the form of secondary
product synthesis by liberation and/or conversion of preformed
intermediates. However, we cannot exclude relatively minor but
possibly relevant contributions from such sources.
The second approach concerns the extent to which the numerous
structural variants of cis-acting elements interact with different
members of the large families of cognate binding proteins. This is
a difficult question to answer conclusively for the situation in vivo.
However, some of the available in vitro assays can give at least
valuable hints in this direction. A sensitive tool for determining
DNA-protein binding affinities is the analysis of band shifts caused
by protein binding of DNA probes on electrophoretic mobility gels.
Fig. 7 shows that a few structurally widely different, elicitor-
responsive, W box-containing elements, including E17 from
PrCMPG1, F from AtCMPGl, and three less precisely defined
promoter regions fromAt4CL4 exhibit distinct binding affinities for
one selected WRKY protein, AtWR;KY11. Importantly, however,
nearly all of these elements are bound more or less efficiently by this
particular family member. Considering the large size of the WRKY
family of W box-binding proteins and the large number of potential
W box-containing sequences and sequence arrangements, this
result indicates a vast regulatory potential founded in an almost
14574 1 www.pnas.org/cgi/doi/10.1073/pnas.0831246100
Hierarchical structure of pathogen defense in plants
Triggered by non-self recognition, executed by interconnected signalling
cascades and superimposed by highly dynamic intracellular rearrangements
Universal strategy
Step-wise progression from
highly localized to systemic defense
Multiple functional components
Papilla formation; hypersensitive cell death,
phytoalexin accumulation; 'systemic acquired resistance'
Regulatory motifs/Metabolic pathways
Cis-acting elements; regulatory proteins; defense related pathways
Genes/mRNAs/Proteins/Metabolites
Species-specific structural and functional elements and pathway characteristics
Fig. 8. Complexity pyramid illustrating the hierarchical organization and mod-
ular structure of the pathogen defense response in higher plants. Note that the
examples used to explain the pivotal role of the two central levels of the pyramid
in the gradual upward progression from the particularto the universal (26) are an
incomplete selection from the modules discussed in the text.
infinite number of possible combinatorial permutations. Particu-
larly relevant with regard to our goal to identify possible causal
connections, it is apparent that any given W box-containing se-
quence has a high potential to bind with a certain affinity to any
given WRKY protein, implicating a similarly wide range of func-
tional relationships in vivo.
The third case exemplifies one of~the most promising and
powerful techniques available for the analysis of causal connections:
the employment of defined mutants. Among the large and rapidly
growing number of A. thaliana knockout mutants, many have been
functionally associated with defined steps in defense-related sig-
naling or secondary product formation, or more generally, with the
disease resistance phenotype. A presently incomplete analysis
employing several such mutants is expected to add substantially to
our understanding of the network of defense-related metabolic
interconnections.
Pathogen Defense in Plants: Paradigm of Structural and
Functional Complexity
At each of the levels investigated, the plant's response to
pathogen attack represents a paradigm of biological complexity
(9~. In addition to the complexity within each individual meta-
bolic level, a hierarchically superimposed complexity pyramid
emerges as the contours of the overall picture come into focus
(Fig. 8~. In accord with the notion of a complexity pyramid
"from the particular to the universal" (26), our results point to
at least three, possibly four distinct levels of hierarchical orga-
nization. At the top of the pyramid, one universal, multicom-
ponent defense strategy governs several more or less universal,
functional modules. Together with the various regulatory motifs
and defense-related pathways at the upper and lower central
levels of the pyramid, respectively, these modules mediate,
coordinate, and execute the strategic response, whereas the
bottom harbors the numerous individual, species-specific, de-
fense-related genes and their products.
Universal Defense Strategy. In P. crispum,A. thaliana, and all other
systems analyzed to date, the overall defense response consists of a
series of sequentially activated defense measures. These proceed
from the highly localized to the less highly localized and finally to
the systemic, with an optional termination of the process at certain
stages when pathogen confinement has been achieved. Among the
most intensely investigated components of this response are the
papilla formed around the site of attempted penetration; the highly
localized, hypersensitive death of the immediately affected cell; the
Hahlbrock et a/.
local accumulation of antibiotically active substances, including
H2O: and phytoalexins; and the systemic accumulation of hydro-
lytic enzymes, such as glucanase and chitinase. This strictly ordered,
temporally, spatially, and functionally modular defense strategy
entails dramatic intracellular rearrangements (10) concomitant
with the onset of transcriptional reprogramming at the infection
site.
However, the individual functional modules are probably not
fully autonomous, but rather interconnected, and in some cases they
may even partially overlap. Obvious examples of such metabolic or
regulatory overlaps are the various interrelated responses to elicitor
stimulation within the plasma membrane; the dual or even manifold
roles of Ca2+ in intracellular regulation; the role of H202 both as
a toxic agent and in cell-wall cross-linking; and the initial, common
steps in the biosynthesis of phenylalanine-derived phytoalexins and
cell wall-bound compounds. Even though the mechanistic details of
such interconnections are presently obscure, the overall response of
the plant reveals that they exist.
Regulatory Motifs and Transcription Factor Families. Both the per-
ception of pathogen-derived elicitors and its subsequent intracel-
lular signal transduction employ basic mechanisms that annear to
be universal not only in higher plants, but also, at least to a
considerable extent, in higher animals (27), suggesting a common
evolutionary origin of the general defense strategy throughout all
higher eukaryotes.
Numerous, more or less directly defense-related genes are major
targets of two of the intracellular signal transduction chains In P.
crcspum (Fig. 1~. Probably all of them contain at least one of a small
number of basic types of elicitor-response element, two of which
(containing either the W box or the P/A/L set of boxes) occur most
frequently on these genes throughout all plants examined. Remark-
ably, the P/A/L box-containing element has so far been found on
all genes encoding functionally identified or putative phenylpro-
panoid-biosynthetic enzymes. Moreover, these genes share, at least
in P. crispum, two additional, remarkable features: they are acti-
vated by the Ca2+/O2-dependent signaling pathway, and the
mRNA accumulation patterns follow identical time courses for all
P/A/L-containing genes, in sharp contrast to the uncoordinated
behavior of nearly all other elicitor-responsive genes analyzed (8~.
Most probably, these three common features are causally con-
nected. Whether this extends to the cognate DNA-binding proteins
remains to be seen.
It presently appears doubtful whether a similar close metabolic
relationship exists among the large number of genes bearing W
box-containing promoters. The W box is not only by far the most
frequently occurring structural element of elicitor-response ele-
ments in plants, but is also notorious for its challenging diversity of
closely spaced repetitions and/or combinations with other se-
quences. In such cases, at least one W box is usually essential for
conveying the elicitor response, and certain types of repeat struc-
ture have been associated with immediate-early gene activation (14,
17, 19~. Fig. 7 exemplifies the broad range of binding affinities
exerted by just a few structurally distinct representatives of such
W-box arrangements toward one selected member of the WRKY
family of transcriptional regulators. This sample includes three W
box-containing fragments from the At4CL4 gene promoter, the
only presently known case in A. thalazna where W boxes cooccur
with the characteristic P/A/L-box set on phenylpropanoid-
biosynthetic genes. The recently identified At4CL4 gene encodes a
rare isoform of 4-coumarate:CoA ligase (4CL) with unusual sub-
strate specificity and may therefore have an exceptional metabolic
function and atypical expression mode. Here, the W-box regions
from the At4CL4 promoter were used to test binding strength
toward WRKY proteins, as predicted from sequence relationships
with previously analyzed elements. The results substantiate these
predictions and furthermore reveal a large influence of the sur-
Hahlbrock et a/.
rounding sequence on the binding affinity of W box-containing
elements.
Although much less is known about the S and D elements, their
identification as strong elicitor-responsive elements indicates that
the diversity of such elements is by no means confined to those
containing P/A/L and W boxes. A particularly interesting recent
observation in this context was the repression by elicitor of previ-
ously UV light-activated genes through a positively UV light-
responsive and negatively elicitor-responsive ACE/ACE element
combination, as manifested in the PeACO promoter fragment
shown in Fig. SA. This inverse response of one promoter element
to different kinds of stress is yet another example of the complexity
and connectivity of regulatory circuits, including the possible in-
volvement of the same family of DNA-binding proteins in both up
and down-regulation of genes (12~.
Taken together, these results reveal a modularity even at the level
of elicitor-responsive gene promoters, with W box- and (metabol-
ically more confined) P/A/L box-containing elements being the
most abundant, universally occurring representatives. Recurrent
modularity in the fine structure of these basic building blocks at the
species and gene levels generates uniqueness and biological spec-
ificity. This principle also applies to the cognate DNA-binding
proteins and to the peripheral transcriptional regulators. Just as
with cis-acting elements, a few distinct classes of transacting factors,
each occurring as structurally diversified families, yield discrete but
universal modules. Thus, the number of functional combinations
for these modules, amplified by homo- and heterodimeric forms,
may parallel the number of physiological challenges to which the
plant must respond.
Binding of a regulatory protein complex is required for inacti-
vation as well as for activation of a gene. Although the mechanisms
of gene inactivation have been studied much less extensively than
those of gene activation, it is unlikely that they fundamentally differ.
Some of our results require us to presume that it may be the
combination of isoforms of a given transcription factor family that
changes with up- or down-regulation of a particular gene, whereas
the basic type remains unchanged (12~.
Metabolic Pathways and Aromatic Secondary Products. A ramified
dimension of complexity is reached at the level of secondary plant
metabolism. In contrast to the cis-acting elements and transacting
factors, many secondary metabolic pathways are unique to certain
plant genera, families or even species, and most of them are
species-specific at least with regard to the specified composition of
the respective product bouquet. Accordingly, all major soluble,
elicitor- or pathogen-induced aromatic compounds in P. crispum
are species-specific mixtures of differently substituted phenylpro-
panoid derivatives, whereas in A. thaliana they are exclusively
indolic intermediates or end products.
It is therefore all the more surprising that, with the exception of
one or two indolic compounds in A. thaliana, all major induced
cell-wall constituents are similar or identical phenylpropanoids in
these two and several other species. Two alternat*es seem equally
plausible: either there is greater evolutionary pressure on the
conservation of the cell wall-bound compounds or this branch of
phenylpropanoid metabolism, whether it has a common evolution-
ary origin in all plants or has converged from multiple origins, has
limited degrees of chemical freedom, in contrast to the various
pathways generating phytoalexins that have evolved a greater
chemical diversity. Although phytoalexin production and cell-wall
reinforcement with phenylpropanoid derivatives can be regarded as
two independent functional modules occupying parallel hierarchi-
cal positions within the overall defense strategy, their species-
specific patterns of diversity could not differ more.
Practical Applications
Our motivation for these investigations has been two-fold: fascina-
tion with an exciting combination of molecular, cellular, and
PNAS I November25, 2003 1 vol. 100 1 suppl. 2 1 14575
ecologically oriented research and the coupling of this excitement
with the expectation that scientific discoveries would reveal new
approaches to breeding disease resistance in crop plants. To reach
this level of practical application, two requirements had to be
fulfilled. First, the basic principles of pathogen defense in plants had
to be understood. We suppose that this stage has been reached with
sufficient clarity, despite many remaining gaps in our knowledge
about the underlying mechanisms. Second, a biologically meaning-
ful, heritable, crop plant-adapted strategy must be feasible in every
respect, including physiological tolerance by the plant and accep-
tance by the public. Comparing the largely unexplored efficiency
and overwhelming diversity of chemical defense, particularly the
difficulty in pinpointing individual, universally applicable (physio-
logically tolerable as well as consumer-friendly) defense-related
compounds, with the proven high efficiency of hypersensitive cell
death as a defense mechanism, we decided on probing a new gene
technology-based strategy in the latter direction.
Our strategy employs the recently identified, rapidly, strongly,
locally, and specifically elicitor-responsive promoter elements (Fig.
3), either alone or in combinations, for example in conjunction with
a gene encoding a cell death-conferring principle, such as a broadly
acting ribonuclease (28~. Transcriptional activation of such a con-
struct on infection of a transgenic plant would cause or intensify
hypersensitive suicidal death of the affected cell, and thus confer or
augment a particularly efficient defense mechanism. A first suc-
cessful proof of principle has demonstrated the feasibility of this
strategy (28~. However, further improvements will be necessary to
adapt various details to the special needs of crop plant breeding. For
example, strict avoidance of unspecific transgene expression in
response to exogenous stimuli other than infections, or to endog-
enous effecters during plant development, is absolutely essential.
This is by no means a trivial obstacle, because most infection-
responsive genes also respond to wounding and other stresses, and,
1. Gus-Mayer, S., Naton, B., Hahlbrock, K. & Schmelzer, E. (1998) Proc. Natl.
Acad. Sci. USA 95, 8398-8403.
2. Nurnberger, T., Nennstiel, D., Jabs, T., Sacks, W. R., Hahlbrock, K. & Scheel,
D. (1994) Cell 78, 449-460.
3. Brunner, F., Rosahl, S., Lee, J., Rudd, J. J., Geiler, C., Kauppinen, S., Ras-
mussen, G., Scheel, D. & Nurnberger, T. (2002) EMBO J. 21, 6681-6688.
4. Fellbrich, G., Romanski, A., Varet, A., Blume, B., Brunner, F., Engelhardt, S.,
Felix, G., Kemmerling, B., Krzymowska, M. & Nurnberger, T. (2002) Plant J.
32, 1-16.
5. Scheel, D. (1998) Curr. Opin. Plant Biol. 1, 305-310.
6. Blume, B., Nurnberger, T., Nass, N. & Scheel, D. (2000) Plant Cell 12,
1425-1440.
7. Kroj, T., Rudd, J. J., Nurnberger, T., Gabler, Y., Lee, J. & Scheel, D. (2003)
J. Biol. Chem. 278, 2256-2264.
8. Batz, O., Logemann, E., Reinold, S. & Hahlbrock, K. (1998) Biol. Chem. 379,
1127-1 135.
9. Somssich, I. E. & Hahlbrock, K. (1998) Trends Plant Sci. 3, 86-90.
10. Gross, P., Julius, C., Schmelzer, E. & Hahlbrock, K. (1993) EMBO J. 12,
1735-1744.
11. Schmelzer, E., Kruger-Lebus, S. & Hahlbrock, K. (1989) Plant Cell 1, 993-1001.
12. Logemann, E. & Hahlbrock, K. (2001) Proc. Natl. Acad. Sci. USA 99,
2428-2432.
13. Rushton, P. J., Tovar Torres, J. T., Parniske, M., Wernert, P., Hahlbrock, K.
& Somssich, I. E. (1996) EMBO J. 15, 5690-5700.
14. Kirsch, C., Logemann, E., Lippok, B., Schmelzer, E. & Hahlbrock, K. (2001)
Plant J. 26, 217-227.
15. Hahlbrock, K., Scheel, D., Logemann, E., Nurnberger, T., Parniske, M.,
14576 1 www.pnas.org/cgi/doi/10.1073/pnas.0831246100
in addition, are expressed during certain stages of development,
such as flowering, senescence or root-tip growth.
Some of the promoter elements listed in Fig. 3, notably E17
and F. are exceptionally specific in their response to infections
(14, 19) and hence may be particularly well suited for the design
of artificial defense mechanisms. Recently published (16) as well
as unpublished data (A.H.) on the specifics of promoter design
and expression modes are aimed at broadening the basis for
further improvements of this strategy, including its sophistica-
tion in detail. In the long term, for this or any other strategy for
breeding disease resistance, multigenic traits will have to be
introduced that are not easily overcome by mutations in the
pathogens.
Conclusions
The combination of a universal strategy with an almost infinite
number of species-specific variations of the pathogen defense
response in plants ideally illustrates the interplay of conceptual
richness, metabolic options, physiological constraints and eco-
logical demands within which evolution takes place. Hierarchical
subdivision of the overall response into multiple functional
modules is executed by interconnected, partly universal, partly
species-specific signaling pathways that together mediate an
extensive, rapid transcriptional reprogramming of exclusively
species-specific genes. A few large, highly diversified families of
cis-acting elements and transacting factors are the pivotal links
between the particular and the universal. The potential for fine
tuning through combinatorial permutations accounts for the
remarkable interspecies functionality of these elements and their
cognate factors in transgenic plants and impels their use in new
strategies of crop plant breeding for an environmentally safe
disease management.
We thank Dr. Bill Martin, Dusseldorf, Germany, and Dr. Dierk Scheel,
Halle, Germany, for valuable comments on the manuscript.
Reinold, S., Sacks, W. R. & Schmelzer, E. (1995) Proc. Natl. Acad. Sci. USA
92, 4150-41S7.
16. Rushton, P. J., Rheinstadler, A., Lipka, V., Lippok, B. & Somssich, I. E. (2002)
Plant Cell 14, 749-762.
17. Eulgem, T., Rushton, P. J., Schmelzer, E., Hahlbrock, K. & Somssich, I. E.
(1999) EMBO J. 18, 4689-4699.
18. Weisshaar, B., Armstrong, G. A., Block, A., da Costa e Silva, O. & Hahlbrock,
K. (1991) EMBO J. 10, 1777-1786.
19. Heise, A., Lippok, B., Kirsch, C. & Hahlbrock, K. (2002) Proc. Natl. Acad. Sci.
USA 99, 9049-9054.
20. Eulgem, T., Rushton, P. J., Robatzek, S. & Somssich, I. E. (2000) Trends Plant
Sci. 5, 199-206.
21. Jakoby, M., Droege-Laser, W., Kroj, T., Tiedemann, J., Vicente-Carbajosa, J.,
Weisshaar, B. & Parcy, F. (2002) Trends Plant Sci. 7, 106-111.
22. Chen, W., Provart, N. J., Glazebrook, J., Katagiri, F., Chang, [I.-S., Eulgem, T.,
Mauch, F., Luan, S., Zou, G., Whitham, S. A., et al. (2002) Plant Cell 14,
559-574.
23. Hagemeier, J., Batz, O., Schmidt, J., Wray, V., Hahlbrock, K. & Strack, D.
(1999) Phytochemistry 51, 629-635.
24. Hagemeier, J., Schneider, B., Oldham, N. J. & Hahlbrock, K. (2001) Proc. Natl.
Acad. Sci. USA 98, 753-758.
25. Maeo, K., Hayashi, S., Kojima-Suzuki, H., Morikami, A. & Nakamura, K.
(2001) Biosci. Biotechnol. Biochem. 65, 2428-2436.
26. Oltvai, Z. N. & Barabasi, A.-L. (2002) Scierlce 298, 763-764.
27. Nurnberger, T. & Brunner, F. (2002) Curr. Opin. Plant B'ol. 5, 318-324.
28. Strittmatter, G., Janssens, J., Opsomer, C. & Botterman, J. (1995) Bio/Technology
13, 1085-1089.
Hahlbrock et a/.
